RM & NS: The Creationist and ID Strawman

AUTHOR: Allen MacNeill
SOURCE: Original essay
COMMENTARY: That's up to you...
Creationists and supporters of Intelligent Design Theory ("IDers") are fond of erecting a strawman in place of evolutionary theory, one that they can then dismantle and point to as "proof" that their "theories" are superior. Perhaps the most egregious such strawman is encapsulated in the phrase "RM & NS". Short for "random mutation and natural selection", RM & NS is held up by creationists and IDers as the core of evolutionary biology, and are then attacked as insufficient to explain the diversity of life and (in the case of some IDers) its origin and evolution as well.
Evolutionary biologists know that this is a classical "strawman" argument, because we know that evolution is not simply reducible to "random mutation and natural selection" alone. Indeed, Darwin himself proposed that natural selection was the best explanation for the origin of adaptations, and that natural selection itself was an outcome that necessarily arises from three prerequisites:
• Variety: significant differences between the characteristics of individuals in populations);
• Heredity: genetic inheritance of traits from parents to offspring; and
• Fecundity: reproduction, often resulting in more offspring than are necessary for replacement.
Given these prerequisites, the following outcome is virtually inevitable:
• Demography: some individuals survive and reproduce more often than others, and hence their heritable characteristics become more common in their populations over time.
As I have alread pointed out in an earlier post, the real creative factor in evolution isn't natural selection per se, it's the "engines of variation" that produce the various heritable characteristics that natural selection then preserves from generation to generation. According to the creationists and IDers, the only source of such variation is "random mutations", and so there simply isn't enough variation to provide the raw material for evolutionary change.
In my earlier post on the "engines of evolution" I promised a list of the "engines of variation" that provide the raw material for evolutionary change. It's taken me a while, but here it is. This list includes "random mutation,' of course, but also 46 other sources of variation in either the genotypes or phenotypes of living organisms. Note that the list is not necessarily exhaustive, nor are any of the entries in the list necessarily limited to the level of structure or function under which they are listed. On the contrary, this is clearly a list of the minimum sources of variation between individuals in populations. A comprehensive list would almost certainly include hundreds (and possibly thousands) of more detailed processes. Also, the list includes processes that change either genotypes or phenotypes or both, but does not include processes that are combinations of other processes in the list, again implying that a comprehensive listing would be much longer and more detailed.
Anyway, here is the list of the "engines of variation", arranged according to level of structure and function (if a term is underlined, you can click on it and be taken to a definition and explanation of that term, usually at Wikipedia):
SOURCES OF HERITABLE VARIATION BETWEEN INDIVIDUALS IN POPULATIONS
Gene Structure (in DNA)
1) point mutations
2) deletion and insertion (“frame shift” / "indel") mutations
3) inversion and translocation mutations
Gene Expression in Prokaryotes
4) changes in promoter or terminator sequences (increasing or decreasing binding)
5) changes in repressor binding (in prokaryotes); increasing or decreasing binding to operator sites
6) changes in repressor binding (in prokaryotes); increasing or decreasing binding to inducers
7) changes in repressor binding (in prokaryotes); increasing or decreasing binding to corepressors
Gene Expression in Eukaryotes
8) changes in activation factor function in eukaryotes (increasing or decreasing binding to promoters)
9) changes in intron length, location, and/or editing by changes in specificity of SNRPs
10) changes in interference/antisense RNA regulation (increasing or decreasing binding to sense RNAs)
Gene Interactions
11) changes in substrates or products of biochemical pathways
12) addition or removal of gene products (especially enzymes) from biochemical pathways
13) splitting or combining of biochemical pathways
14) addition or alteration of pleiotropic effects, especially in response to changes in other genes/traits
Eukaryotic Chromosome Structure
15) gene duplication within chromosomes
16) gene duplication in multiple chromosomes
17) inversions involving one or more genes in one chromosome
18) translocations involving one or more genes between two or more chromosomes
19) deletion/insertion of one or more genes via transposons
20) fusion of two or more chromosomes or chromosome fragments
21) fission of one chromosome into two or more fragments
22) changes in chromosome number via nondisjunction (aneuploidy)
23) changes in chromosome number via autopolyploidy (especially in plants)
24) changes in chromosome number via allopolyploidy (especially in plants)
Eukaryotic Chromosome Function
25) changes in regulation of multiple genes in a chromosome as a result of the foregoing structural changes
26) changes in gene expression as result of DNA methylation
27) changes in gene expression as result of changes in DNA-histone binding
Genetic Recombination
28) the exchange of non-identical genetic material between two or more individuals (i.e. sex)
29) lateral gene transfer via plasmids and episomes (especially in prokaryotes)
30) crossing-over (reciprocal and non-reciprocal) between sister chromatids in meiosis
31) crossing-over (non-reciprocal) between sister chromatids in mitosis
32) Mendelian independent assortment during meiosis
33) hybridization
Genome Structure and Function
34) genome reorganization and/or reintegration
35) partial or complete genome duplication
36) partial or complete genome fusion
Development (among multicellular eukaryotes, especially animals)
37) changes in tempo and timing of gene regulation, especially in eukaryotes
38) changes in homeotic gene regulation in eukaryotes
39) genetic imprinting, especially via hormone-mediated DNA methylation
Symbiosis
40) partial or complete endosymbiosis
41) partial or complete incorporation of unrelated organisms as part of developmental pathways (especially larval forms)
42) changes in presence or absence of mutualists, commensals, and/or parasites
Behavior/Neurobiology
43) changes in behavioral anatomy, histology, and/or physiology in response to changes in biotic community
44) changes in behavioral anatomy, histology, and/or physiology in response to changes in abiotic environment
45) learning (including effects of use and disuse)
Physiological Ecology
46) changes in anatomy, histology, and/or physiology in response to changes in biotic community
47) changes in anatomy, histology, and/or physiology in response to changes in abiotic environment
So, next time you hear or read a creationist or IDer cite "RM & NS" as the sole explanation for evolutionary change, point out to them and everyone else that there are at least 47 different sources of variation (including "random mutations"), and at least three different processes that result from them: natural selection, sexual selection, and random genetic drift.
Comments, criticisms, and suggestions (especially additional items for the list) are warmly welcomed!
--Allen
Labels: engines of variation, evolution, genetic variation, intelligent design, phenotypic variation


53 Comments:
Not so much an addition as perhaps a minor correction with the deletions. Not all deletions necessarily result in a frameshift, although of course this would be the most common for deletions of any multiple not of three. But it is certainly possible for 3 (or some multiple of 3) nucleotides to be inserted or deleted at the same time resulting in insertion/deletions of the protein primary sequence. This seems to be especially prevalent in loop regions of the protein three-dimensional structure and may be one of the mechanisms by which new protein domains occasionally arise.
Allen, as a fellow biologist there are several points that I would take issue with you. First, you provide the label ”evolutionary biologist”. I thought we were biologists but since it seems that we must take camps, then call me a “creationary biologist”. Now settled, we move on.
Creationists didn’t take on ID as a strawman and it is unfair to state such. ID stands aloneon its own merits. It lacks much of the facets that constitute creationism. ID is supportive in providing evidence for design that concludes with a designer, but beyond that can in no way be considered a strawman. To do so is an injustice. Just as relegating all scientific evidence for Creation as “religion” is the favorite ploy for denigrating evidence to prevent its consideration. It’s “throwing the baby out with the bath water”.
I find it interesting also that, unless I’m reading too much into it, you are nearly dispensing almost entirely with the concept of natural selection in favor of variation and adaptation I love your statement, “the real creative factor in evolution isn’t natural selection”. If this is the case, I am in total agreement. Variation is a slam dunk, something everyone can observe. Where we depart is that I believe variation to have limits imposed by the viability and diversity of the gene pool for each respective kind of creature. Not much variation with the elephant kind with only two variants, but unlimited variation with the dog kind with 250 accepted “breeds” and countless variants as mongrels.
If natural selection is akin to “survival of the fittest”, I maintain that it is the reason why evolution is impossible. One example is the universal acceptance by evos that birds evolved from reptiles. Somewhere midway, its forelimbs could neither function as legs nor wings. With severely impaired mobility it is subject to predation, unable to seek food and hardly capable of procreation. These are liabilities that would render it unfit and seal its doom. In all cases where something is changing to something else, there would clearly be a time when the physical demands imposed by overwhelming physiological changes would at some time in the transition cause it to become unfit and unable to survive. Ah, but the evolutionist would argue that these changes could magically occur because of the mystical power of time, lots and lots of it. Evos must have coined the saying,”time heals all wounds”. It certainly works for them.
I am not privy to the research done by you in developing your 47 points. You describe it as a “list of real sources of variation”A cursory read seems to show a lot of variation and adaptation within kinds but no evidence of evolution i.e. the change of something into something else. I subscribe that variation ain’t evolution! There’s a lot of variation in dogs but never has one become a cat or wildebeest or...
Kenneth Miller, co-author of a popular Biology textbook, and apologist for evos, covers in the early part of the text the subject of spontaneous generation and the various and sundry analyses and results, concluding with the “refutation of the hypothesis of regeneration”. Pasteur concluded that “ all living things come from other living things” Somehow, he failed to consider evolution as the one exception.
My career in the scientific community was exclusively applied, working on NASA projects and R&D on artificial heart and kidney devices. I can assure you that evolution was never a part of the equation and that evolution as the foundation of science is a bogus myth and only in the minds of the beholder. What useful product was dependent on a belief in evolution? Evolution is necessary comfort for the atheist or the academician, like you, whose livelihood is dependent upon teaching the party line. As scientists we are responsible to seek and share truth, to examine all aspects and draw conclusions from the weight of the evidence. Sadly, too many compromise, opting to suppress evidence that suits our mindsets.
First, you provide the label ”evolutionary biologist”. I thought we were biologists but since it seems that we must take camps, then call me a “creationary biologist”.
I thought everyone knew that the term "evolutionary biologist" doesn't mean "biologist who believes in evolution". It means "biologist who studies evolution". It's not a "camp", it's a specialization - just like "microbiologist", and "marine biologist" isn't a "camp".
Creationists didn’t take on ID as a strawman and it is unfair to state such. ID stands aloneon its own merits. It lacks much of the facets that constitute creationism. ID is supportive in providing evidence for design that concludes with a designer, but beyond that can in no way be considered a strawman. To do so is an injustice.
??? Did you read the essay, and are you familiar with the term "strawman". You're arguing against something that was never in the article, and using "strawman" in a very unconventional way. I think you missed the point of the article, and the meaning of the term "strawman".
Not much variation with the elephant kind with only two variants, but unlimited variation with the dog kind with 250 accepted “breeds” and countless variants as mongrels.
What's the difference between two different breeds of dogs? Some genetic differences here and there. From a genetic standpoint, what's the differences between, say, humans and chimpanzees? A whole bunch of little genetic differences. So, your argument is that mutations can cause two organisms of the same species to have millions of genetic changes/differences, but more time can't produce a hundred million genetic changes/differences? That's simply not a credible opinion. It's sort of like saying loose change will never amount to anything approaching the value of a dollar.
Ah, but the evolutionist would argue that these changes could magically occur because of the mystical power of time, lots and lots of it.
Magically, huh? Have you looked up the meaning of the word "strawman" yet? Seems to me it is the evolutionists who are doing the math, and looking up the genetic differences all the way down to the genetic level. The creationists are the ones invoking magic.
I subscribe that variation ain’t evolution! There’s a lot of variation in dogs but never has one become a cat or wildebeest or...
That's because genetic changes are small. The genetic differences between a dog and a cat are likely somewhere around 400-500 million genetic differences. Random mutation works slowly - as changes are more likely to be harmful than helpful. Further, a dog's genetics aren't going to "magically" make the 400-500 million changes needed to change it from a dog to a cat in one generation - nature isn't trying to turn dogs into cats, most random changes would not only be harmful, and random forces would be incredibly unlikely to make the exact changes needed to convert it to a cat. That's a pretty ridiculous argument, and if you think that's an argument against evolution, you need a reality check in a major way. The only thing that would change a dog into a "a cat or wildebeest" is an "intelligent designer". The fact that we haven't seen it means what? - That there is no intelligent designer?
Sadly, too many compromise, opting to suppress evidence that suits our mindsets.
Ironic that you should say that.
Dear tinyfrog, Thanks for the response. I assume that you are responding for Allen. Are you his mentor?
At any rate, I don’t follow you on your definitions. I study evolution. Does that make me, God forbid, an evolutionary biologist? I also study creation and if they are not camps, now I am so confused as to what to call myself.
Allen doesn’t leave much to the imagination as to his meaning of strawman. He repeatedly uses it to mean a shill or substitute, regardless of how you interpret it. That same ploy is used with any evidence supporting creation where they are quick to label it religion so as to disparage it, denigrate it and take it out of the discourse.
You say that there are 400-500 million genetic differences. Where did you get that? But isn’t that the standard fare for evos to use astronomically huge numbers that no one can prove or disprove or for that matter substantiate? How well the ridiculous numbers game is played. Have you not heard of the Second Law of Thermodynamics, entropy and the fact that rarely do mutations benefit the species?. All you need to add is millions of these genetic differences over billions of years and, shazam, end of debate. You seem to agree that mutations are harmful so I’m not sure where you are coming from.
I can’t fathom your statement where you genetically equate two different breeds of dog and the difference between humans and chimps? Dogs are dogs, both of the same kind, humans and chimps are not the same kind. Boy is that a far stretch!
Don’t understand your last paragraph. Are you suggesting that there is a designer? If so, I’m in accord. You say that changing a dog into a cat needs a designer. That’s right. You can’t change something into something else through natural selection. Stay well.
Ron,
The Argument from the Second Law of Thermodynamics is one that even the major Creationist groups have abandoned because it is not a scientifically valid argument. You said you are a biologist, I did my undergrad in Biochemistry and am currently pursuing my Masters degree in Computational Biology, as part of my studies I took Physical Chemistry which encompasses Thermodynamics. Any scientist should know that the Argument from Thermodynamics against Evolution is, quite simply, ridiculous and has zero scientific merits, being based on a horribly inaccurate understanding of thermodynamics in general, and the Second Law in particular.
In one post you claim you study physiology and related, and that 'evolution never entered the equation', and in a second post claim to study evolution. Which is correct? Evolution is the foundation of modern biology, although it is possible to happily perform much research in biology without acknowledging evolution overtly. Many researchers in various fields of biology such as biochemistry/molecular biology, physiology, etc. do so. Many more such scientists barely have any understanding of evolution beyond a superficial, and many times horribly flawed one. Something I have noticed with my limited experience.
ID does not stand on its own merits, if it did it would be performing the same way evolutionary biology did in its first entry into the scientific world, and that is by producing good solid scientific research that stood on its own merits. Published in peer reviewed journals and making testable predictions. Some of which were right, some of which were wrong. The incorrect ones doing as much to advance the field, perhaps more, than the correct ones. The work done before, during, and after the modern synthesis still stand as some of the finest scientific research conducted in biology period. (As well as other fields such as statistics).
Allen's post doesn't give up Natural Selection, he is simply trying to highlight the means of producing variation that are often overlooked by Creationists/ID'ers when they invoke "Random Mutation and Natural Selection". There is more to evolution than random mutation and natural selection, as is being pointed out in this blog post. In particular Allen is highlighting the various other mutations (other than single point mutations) and other means/mechanisms of providing variation.
BTW, I think I figured out your confusion in your first post. It appears that you've confused the term "strawman" with "trojan horse".
You say that there are 400-500 million genetic differences. Where did you get that? But isn’t that the standard fare for evos to use astronomically huge numbers that no one can prove or disprove or for that matter substantiate?
What are you talking about. It was a guestimate. Humans and chimpanzees share something like 96% of their DNA in a genome of 3 billion base pairs. That works out to approximately 120 million differences. (I should add that it's not 120 million separate events - since an insertion, deletion, or duplication could make thousands of changes in one event.) I guesstimated that dogs and cats have quite a bit more differences - and guessed about 4 times as much. Looking around on the web a bit makes me think I underestimated. According to genetic analysis, the differences between lions and a domestic housecat are about twice as large as those between humans and chimpanzees. That would mean they probably have around 200-300 genetic differences. Dogs, which aren't part of the "cat" group are going to have even more genetic differences. So, you're your complaints about 'throwing around big numbers' is actually pretty weak since I'm clearly in the right ballpark - but that doesn't stop you taking pot-shots.
http://www.corante.com/loom/archives/2006/01/05/catblogging_from_deep_time.php
You seem to agree that mutations are harmful so I’m not sure where you are coming from.
I agree that mutations are more likely to be harmful than helpful, but that doesn't change anything since I also know that natural selection filters out the bad ones while it promotes the spread of good ones. How can you not know this if you are a biologist?
I can’t fathom your statement where you genetically equate two different breeds of dog and the difference between humans and chimps?
Because I bring everything down to a genetic level. Two organisms of the same species have some differences, and two organisms of different species have a lot of genetic differences.
Dogs are dogs, both of the same kind, humans and chimps are not the same kind. Boy is that a far stretch!
The "kinds" that you speak of are your own mental constructs - they are not immutable.
By the way, as I stated earlier, lions and housecats are more genetically different than humans and chimpanzees. You would call lions and housecats one "kind", but say humans and chimpanzees aren't one "kind" - even though we are twice and similar genetically as lions and housecats.
Let's say that I showed you the genetic code of three different organisms:
(1) acgacugcaugcaugcaugcaugcaucga
(2) acgacAgcaugcaugcaugcaugcaucga
(3) acgacGgcauUcaugcaugGUugcGucga
Organisms 1 and 2 differ at one location. Organisms 2 and 3 differ at 5 locations. Now, I tell you organism 1 was a breed of dog, and organism 2 was a breed of dog, but organism 3 was a cat. You might say, "Well, gee, if we started with organism 1, it might become organism 2 - because they're both dogs. But, organism two can't turn into organism 3 because it's a cat!" I'm scratching my head at this point, because once you accept that new mutations can enter the gene pool to turn organism 1 into organism 2, I don't understand why organism 2 can't turn into organism 3 - which has five times the genetic changes. You cite some mystical barrier called "kinds", but that barrier doesn't exist anywhere but in your own mind. You complain that those 5 genetic changes don't happen in a single generation, and I'm saying why would all those exact changes happen simultaneously? Cats and dogs have a lot more than 5x the differences than two different breeds of dogs, but the principle still holds - and it also means that no evolutionist expects the millions of mutations to occur that would somehow "prove" evolution. In reality, evolution says it is astronomically unlikely to happen the way you say "it should". And, no, the second law of thermodynamics does not prevent any of this from happening.
You may add exon shuffling. It belongs to the gene structure section (insertions/deletions) but in most cases the reading frame isn't changed. I would further add exonization of transposable elements usage of alternate promoters, alternative splicing, multiple polyA signals and trinucleotide repeat expansions.
Hi Allen,
Your participation on Uncommon Descent is missed.
I have a question for you. Presumably all the evolutionary mechanisms you list are available to the well studied eukaryote P.falciparum. In billions of trillions of replications over the last several decades falciparum essentially remained the same organism in both genotype and phenotype. Yet in orders of magnitude fewer replications reptiles somehow evolved into mammals.
Can you reconcile the observed lack of progressive evolution of falciparum with the unobserved progressive evolution of reptile to mammal using any or all of the evolutionary mechanisms in your list?
Kind regards,
DaveScot
It looked interesting at first. Imagine - a creationist biologist chipping in on the discussion. Then it turned out Ron has a grasp of evolution and logic to rival Kent Hovind and it got pretty dull pretty quick (although the responses to the standard canards have been particularly clear).
What I notice most is how common it is for creationists to imply they have more authority than they actually do. A creationist might well be a horticulturist who reads a lot of articles on AIG, but describing that as "a biologist" who "studies evolution" seems to create the possibility that people will assume he is something like an evolutionary biologist (not realising that this possibility evaporates as soon as he starts actually discussing evolution). I once argued with a creationist who haughtily announced that she was "qualified to teach biology in high school". Now this may have just meant she worked in a system where they let an English major take junior science if there's a shortage of teachers. It certainly didn't mean she had a degree in biology from a real college, otherwise she would have just said so. But obviously she would have been only too happy if I had mistakenly inferred that. I wouldn't be ranting about this, except I've seen this a hundred times I kid you not. I think the mindset is: "as I'm right anyway, it doesn't hurt if someone accidentally assumes I speak with authority - it will merely expedite my argument and save me the trouble of arguing all those fiddly details that evolutionists are always going on about". In admirable contrast, the articles written by real scientists with immaculate credentials proceed by presenting the argument itself, and the author tends to have much more interest in how you judge the argument than how you judge the author.
tiny frog,
As it happens, in a link at Panda's Thumb, one finds this: "...chimps and humans do differ genetically by more than 1%, but our genes–in contrast to what the Scientific American posting states–are only 1.23% different. "
So you did underestimate.
Ron Cote claims to have studied evolution but wrote "There’s a lot of variation in dogs but never has one become a cat or wildebeest or... "
That sentence fragment alone tells me his 'studies' of evolution have been extremely superficial. There is no biologist who claims evolution could turn a dog into a cat. If it happened, it would be a major blow to the theory of evolution and lend more support to creationism.
The rest of his comments are a mishmash of creationist strawmen that provide additional evidence that he needs to take a basic biology course that includes an outline of evolutionary theory.
Dr. MacNeill,
Comments, criticisms, and suggestions (especially additional items for the list) are warmly welcomed!
At the very beginning of your article you used the term "Intelligent Design Theory." There is, in fact, no such thing.
Hope this correction helps,
Jack
Allen,
It would be very nice if you could fold a whole 'nother universe of genetic and regulatory mechanisms into your list. For the sake of completeness, and because the ID movement (typified by Behe's recent dismissal of these core mechanisms) cannot deal with the concept.
I speak, of course, of the regulation of gene expression at the level of RNA and protein breakdown. Not only are they central to life (it's doubtful that multicellular life could exist without the negative regulatory mechanisms afforded by these processes), they are inherently "accessible" to evolutionary modification. This is because, in the ID vernacular, they involve low information modes of recognition and action.
Keywords for a revised list: microRNA, siRNA, exosome, ubiquitin, cullin, E3 ligase, proteasome, SUMO.
Great additions SPARC, since I work on protein evolution I really should have remembered to add exon shuffling. Along the same lines of alternative splicing we also have RNA editing. It isn't carried out in many known systems but its an interesting system as well.
Ron Cote wrote:
"Allen, as a fellow biologist..."
Can you direct us to some of the data you've published in the primary biological literature?
"...call me a “creationary biologist”. Now settled, we move on."
Not so fast! Please point us to the data you produced and/or published from testing creationist hypotheses.
"Creationists didn’t take on ID as a strawman and it is unfair to state such. ID stands aloneon its own merits. It lacks much of the facets that constitute creationism. ID is supportive in providing evidence for design that concludes with a designer,..."
ID provides zero evidence, Ron. No ID proponent anywhere has sufficient faith to test an ID hypothesis.
"... but beyond that can in no way be considered a strawman."
You clearly don't understand the meaning of the term.
"If natural selection is akin to “survival of the fittest”,..."
It isn't, Ron. It's REPRODUCTION of the fittest. You're not really a biologist, are you?
"My career in the scientific community was exclusively applied, working on NASA projects and R&D on artificial heart and kidney devices."
It sounds like you were an engineer.
I'm not a biologist, either but I sort of doubt that a biologist would write this:
Somewhere midway, its forelimbs could neither function as legs nor wings. With severely impaired mobility it is subject to predation, unable to seek food and hardly capable of procreation.
I don't think a real biologist would have overlooked the use of forelimbs as "arms" not needed for walking or flying (yet) in a wide range of bipedal dinosaurs such as the (probably feathered) Oviraptor.
http://en.wikipedia.org/wiki/Oviraptor
Even little children know that bipedal dinosaurs like T. Rex walked on only two legs. T. Rex mobility was certainly not impaired.
Joe Mc Faul sealawr@aol.com
Allen --
Great list!
I take issue, however, with your characterization of what the ID side says.
ID does not say that all evolutionary biology is RM+NS. Instead, what it says is that RM+NS is the only atelic form of evolution. Many if not all of the other ones on your list are teleological -- that is, they are operating in a way that is in a great degree restricted to what would be biologically useful.
The point of ID is not that all evolutionary biology is wrong. In fact, most ID'ers are in agreement with a great amount of evolutionary biology.
The issue is that, with the exception of RM+NS, all of the other engines of variation point to designed/pre-programmed mechanisms of change.
If you are saying that RM+NS is a minority form of evolution compared to the more teleological forms, then you are actually agreeing with the ID'ers, not disagreeing with them.
The point you made: "the real creative factor in evolution isn't natural selection per se, it's the source(s) of variation" is PRECISELY the point that ID'ers have been trying to point out.
Now, often times, when debating evolutionary biologists, it is the evolutionary biologist (not the ID'er) who will simply assume that all of those other engines of variation can be fashioned from a precursor system that used only RM+NS (I have had personal experience with this with a professional biologist who writes for TalkOrigins).
The reason RM+NS is often used, is precisely because the power of RM+NS is only part of evolutionary theory which ID disagrees with. As I pointed out, many evolutionary biologists understand this, and to prevent the teleological understanding of evolution, they simply assume that the other mechanisms are ultimately subsumed in RM+NS. Dawkins for one takes this approach, as does most of the biologists associated with Talk.Origins, as do many of the biologists associated with the debate.
So it seems that perhaps your disagreement is not with ID but with other evolutionary biologists involved in the debate?
Isn't "random mutation" just a catch-all term for all or most of the 46 other kinds of mutations in your list?
Don't Darwinists believe that evolution is an undirected process, and aren't undirected processes random?
Also, co-evolution -- the mutual evolution of co-dependent organisms such as bees and flowering plants -- presents a diliemma for evolution. In co-evolution, unlike evolutionary adaptation to fixed widespread physical features of the environment, e.g., water, land, air, and climate, there may be nothing to adapt to because the corresponding co-dependent trait in the other organism may be initially absent.
Dr. MacNeill,
Would it be better if ID'ers used the term "variation and selection" instead of "RM + NS"?
Dear Smokey, you seem hung up on what I might have published. Of what significance is that? I published nothing, zip, nada. My work experience was in the R&D of products of usefulness to mankind not in producing papers demonstrating how smart I was. Papers are the product mostly of those in research and academia. That was not my occupation. Have you published any papers? To proclaim that Behe and ID shows no evidence is astounding, but, I guess typifies the average evo mentality that “don’t confuse me with the facts, my mind is made up!”
If you need for me to provide a label, I am a creationist bio-engineer. How’s that? And If you were an astronaut on an EVA mission or a patient on peritoneal dialysis, you wouldn’t care what I was or what papers I might have written.
In all of the literature NS is referred to as “survival of the fittest”. You just arbitrarily changed it to “reproduction”. I assume that you have written a paper on this new concept.
To Anonymous, As a real biologist, I am fully cognizant that certain animals were bipedal. You imply that as such they could sacrifice use of their forelegs, as if they served no function, at all. The point being made, that you apparently ignored, is that at some point in the evolutionary process, certain appendages, organs, physiological processes, functions etc.had to be undergoing traumatic and dramatic metamorphic changes that would inevitably weaken the species, causing it to become unfit. Please explain when forelimbs transitoned into wings, how long it took for them to function for flight and where the fossil, or any other evidence exists to demonstrate this occurence.
Ron wrote,
"Dear Smokey, you seem hung up on what I might have published."
Not at all, Ron. I even wrote, "Please point us to the data you produced and/or published from testing creationist hypotheses."
Your data don't even have to be published, but to call yourself a "creationary biologist," you should have produced some new data from testing creationist hypotheses.
"Of what significance is that? I published nothing, zip, nada. My work experience was in the R&D of products of usefulness to mankind not in producing papers demonstrating how smart I was."
You were lying when you called yourself a biologist. Moreover, we don't produce papers to demonstrate how smart we are, we produce them to share our new data with the rest of the world. Real scientists produce new data. It's that simple.
"Papers are the product mostly of those in research and academia. That was not my occupation. Have you published any papers?"
Yes, more than Behe, and more important ones, too.
"To proclaim that Behe and ID shows no evidence is astounding, but, I guess typifies the average evo mentality that “don’t confuse me with the facts, my mind is made up!” "
You're lying again, Ron. I didn't write about SHOWING evidence cherry-picked from others. I wrote, "ID provides zero evidence, Ron. No ID proponent anywhere has sufficient faith to test an ID hypothesis."
If you're doing science, you PRODUCE NEW EVIDENCE from testing your own hypotheses. You reject science while lying and calling yourself a scientist.
"If you need for me to provide a label, I am a creationist bio-engineer. How’s that?"
It's much more honest than calling yourself a biologist.
"In all of the literature NS is referred to as “survival of the fittest”."
Wanna bet?
"You just arbitrarily changed it to “reproduction”."
No, I didn't. Hell, Darwin wrote a whole chapter on sexual selection in OoS. It included new data, too!
DaveScot asked:
"Can you reconcile the observed lack of progressive evolution of falciparum with the unobserved progressive evolution of reptile to mammal using any or all of the evolutionary mechanisms in your list?"
Easily: in two words, the answer is "stabilizing selection." If we assume (as virtually any evolutionary biologist would) that Plasmodium falciparum is adapted to its niche as a parasite of mammalian erythrocytes, then as along as mammalian erythrocytes remain basically unchanged in structure and function, any significant deviation from the adapted structure and function of P. falciparum would necessarily result in the demise of any deviant individuals.
In other words, the simplest explanation of the unchanged nature of P. falciparum over the time period specified is that any deviation from that nature would be selected against. This is precisely why we observe almost no change in the parts of the genome of P. falciparum that code for its adaptations, but significant changes in parts of its genome that are selectively neutral.
By contrast, the evolutionary divergence of mammals from reptiles was accompanied by huge changes in the environment (occurring primarily during the Permian-Triassic crisis, as abundantly documented in the fossil record), and was apparently facilitated primarliy by corresponding changes in hox regulatory genes in the diverging lines (as documented in the differences in hox genes in reptilian versus mammalian clades).
In other words, the non-divergence of P. falciparum is easily explained as a consequence of stabilizing selection, while the divergence of reptiles and mammals is explained as a consequence of directional selection. This is basic, sophomore level evolutionary biology, Dave.
Allen - is my reply to Larry Fafarman stuck in moderation, or did you not accept it?
Allen,
I think that you have to add something to your preconditions for natural selection, success at reproduction based on variable traits.
To amplify just a little bit on Smokey's responses to Ron Cote's post:
1) Publication in peer-reviewed scientific journals is not only relevant here, it is pretty close to the whole point. When a paper is published in such a journal, it is a sign that the author has jumped over all of the relevant hurdles: s/he has clearly indicated the hypothesis to be tested, has clearly outlined the materials and methods used to test the hypothesis, has clearly presented the results of the tests used, and has discussed the implications of those results for the original hypothesis; has it been verified or falsified? If you haven't done one or more of these things, you haven't been doing science. Quod erat disputandem?
2) No professional evolutionary biologist refers to natural selection as "survival of the fittest." Indeed, even Darwin didn't: the phrase "survival of the fittest" was coined by Herbert Spencer (see http://en.wikipedia.org/wiki/Survival_of_the_fittest), and was only adopted by Darwin in the sixth and final edition of the Origin of Species as an alternative formulation of what Darwin preferred to call "natural preservation" (see letter from C. Darwin to C. Lyell, dated 28 September 1860).
Evolutionary biologists do refer to "fitness", but as Smokey has already pointed out, fitness is defined as differential reproductive success: that is, those individuals who have the largest percentage of offspring surviving to reproductive age have the highest relative fitness in the population of which they are members.
One more comment vis-a-vis DaveScot's earlier post:
Along with most evolutionary biologists, I am very leery of the term "progressive" when used in an evolutionary context. The word "progress" implies that evolution is tending toward something. Indeed, in many formulations of evolution (c.f. Lamarck's Philosophie Biologique or Teilhard De Chardin's Phenomenon of Man), evolution is assumed to be a progressive process, with its ultimate goal being the production of ourselves, the "paragon of animals." But, as Stephen Jay Gould often pointed out, evolution is not necessarily progressive, nor does it necessarily lead to us. Indeed, if one accepts (as MIchael Behe does) that evolution has been happening on Earth for about 3.8 billions years, and if you assume (again, as Michael Behe does) that all currently existing species are the result of Darwinian descent with modification from common ancestors, then one should just as easily say that the 3.8 billion year pageant of evolution has proceeded in order to bring about the production of pubic lice, or dung beetles, or bread mold, or P. falciparum, or any other currently existing species.
Allen wrote:
"1) Publication in peer-reviewed scientific journals is not only relevant here, it is pretty close to the whole point."
Allen, I'd disagree. The real criterion is whether they have produced ANY data at all from testing a creationist/ID hypothesis (they haven't).
They can publish it on a Web site, cocktail napkin, or their own journal that hasn't been published in two years.
The bottom line is PRODUCING NEW data, not citing someone else's. Their failure to produce a single new datum speaks volumes about their lack of faith in their hypotheses, as do their attempts to portray science as dueling, new data-free essays aimed at laypeople.
David:
I don't have a record of your submitting a response to Larry Farfarman – maybe the spam filter ate it? Please resubmit it for moderation.
--Allen
Allen, I think most of your list can reasonably be considered RM, so I think the number 47 is a bit misleading in this context.
IAC, what is your definition of random mutation? I ask because I consider the concept of random mutation to be unscientific as it is used in practice.
Cheers, :)
Allen_MacNeill you stated over at UD:
However, the only way to answer this question is to do the relevant empirical research, testing falsifiable hypotheses that distinguish clearly between the two. So far this has not been done, especially by IDers.
I take issue with that statement.
Since Patrick already pointed to Dr. Behe’s work, in which malaria was subjected to extreme pressure to evolve complexity and failed to generate even one novel protein/protein binding site.
I will refer you to my post on #7, it is one of many studies verifying the principle of Genetic Entropy (the marriage of the second law with conservation of information) (The exact opposite of the evolutionary theory). This study is unique in that it clearly demonstrates loss of variability over approximately 250 million years for trilobites:
I maintain that over 250 million years severe environmental pressure would have been introduced at some time for the trilobites to evolve more complexity not less!
Thus your assertions are found wanting in only this first study I’ve collected for long time span analysis of a species!
http://www.terradaily.com/reports/The_Cambrian_Many_Forms_999.html
Of special note:
So for his Science study, Webster combed through 68 previously published studies of trilobites, searching for descriptions of evolving characteristics that could be incorporated into his analysis. After eliminating studies that were inappropriate for inclusion, 49 still remained.
He focused on actively evolving characteristics. The trilobite head alone, for example, displays many such characteristics. These include differences in ornamentation, number and placement of spines, and the shape of head segments. His findings: Overall, approximately 35 percent of the 982 trilobite species exhibited some variation in some aspect of their appearance that was evolving. But more than 70 percent of early and middle Cambrian species exhibited variation, while only 13 percent of later trilobite species did so.
“There’s hardly any variation in the post-Cambrian,” he said. “Even the presence or absence or the kind of ornamentation on the head shield varies within these Cambrian trilobites and doesn’t vary in the post-Cambrian trilobites.”
Allen_MacNeill, what do you want to bet that every long term analysis of a species I can get my hands on will fall into this loss of variability category, thus conforming to Genetic Entropy,,,,Thus, I am making a clear prediction that can clearly be falsified,,,Indeed if variability is found to increase over long periods of time in the fossil record then Genetic Entropy will be tentatively falsified for introduction of information at level of parent species…That is a lot more than I can say for evolution for, from what I’ve seen in the way it can explain anything, evolution can never be falsified!
Thank you,
Bornagain77
As Niles Eldredge and Stephen Jay Gould pointed out almost three decades ago, the general pattern for the evolution of diversity (as shown by the fossil record) follows precisely this pattern: a burst of rapid diversity following a major ecological change, and then a gradual decline in diversity over relatively long periods of time. This is clearly the case among east African cichlid fish, such as those in Lake Malawi and Lake Victoria. As numerous studies have pointed out, Lake Victoria is only a little over 12,000 years old, while Lake Malawi is approximately 1.5 million years old. Lake Victoria has (or had, until the introduction of the Nile perch) over 600 species of cichlids, while Lake Malawi has many, many fewer (the exact numbers are not known, due to rapid species turnover and the difficulty of sampling fish species in these lakes). In other words, the older the lake, the lower the species diversity.
This general pattern is also observable among the arthropod phyla in the "Cambrian explosion", the vertebrate tetrapod taxa following the Permian-Triassic mass extinction, and the mammalian phyla following the Cretaceous-Teritary mass extinction. This is precisely what macroevolutionary theory predicts: adaptive radiation, followed by species "pruning", caused mostly by increasing niche specialization and the squeezing out of marginally adaptive taxa.
Over deep evolutionary time, however, species diversity has shown a steady increase: there are more species of animals alive today than at any time in the preceding 600 million years. That is, although species diversity declines within taxa, the overall number of higher taxa increases over time. This is because macroevolution includes a kind of "rachet": mass extinctions rarely if even eliminate an entire set of higher taxa. Even the Permian-Triassic mass extinction didn't kill all of the multicellular organisms on Earth (only about 99% of them). And then, as the surviving taxa rapidly diversified into the now-vacant adaptive zones, the new taxa were added to the survivors.
Is this version of macroevolutionary theory non-falsifiable? On the contrary, it could easily be falsified by showing (in the fossil record) that intra-taxonomic diversification increases steadily over deep evolutionary time. This finding would verify the gradual diversification model that Eldredge and Gould called "phlogenetic gradualism" and falsify their alternative hypothesis of "punctuated equilibrium." However, as more and more evidence has accumulated about the adaptive radiation of various taxa following major extinctions, it is clear that Eldredge and Gould's model has more empirical evidence supporting it.
Now, just how much empirical evidence has ID going for it? The only published books and papers that I'm aware of (and I've read almost all of them) are theoretical models and alternative interpretations of already existing evidence, virtually all of it collected and published by evolutionary biologists. Until IDers start doing actual empirical science, their "theories" will remain untested hypotheses, and their ideas will consist virtually entirely of airy speculation.
Allen, you commented on the importance of peer reviewed publications. Wasn’t Archeoraptor published in National Georaphic magazine a “peer reviewed” publication?
You stated “No professional evolutionary biologist refers to natural selection as "survival of the fittest." Indeed, even Darwin didn't:". I refer you to the textbook “Biology” co-authored by Kenneth Miller and Joseph Levine. In the section titled “Survival of the Fittest", pages 380 and 381 it states” This was a process that Darwin called survival of the fittest. ” It goes on to state,”Because of its similarities to artificial selection, Darwin referred to the survival of the fittest as natural selection”.
Your allegations are in conflict with what is being taught as evolutionary doctrine in public schools!
The article in National Geopgraphic was not considered peer=reviewed, just like any article in Natural Geographic is not considered peer-reviewed. No scientist would ever pretend this to be the case so why do you feel it necessary to push it as if it is? There were mistakes with the handling of archeoraptor surely, but using misinformation to support your argument is weak.
No, National Geographic is a popular magazine and is not anything remotely like a peer-reviewed professional journal. As I pointed out in my previous post, the phrase "survival of the fittest" was not coined by Darwin; it was coined by Herbert Spencer, and only adopted by Darwin (with some reluctance) in the sixth and last edition of the Origin of Species. Darwin didn't even prefer the term "natural selection." In a letter to the eminent geologist Charles Lyell (dated 28 September 1860), Darwin stated that he preferred the term "natural preservation," but that by then his original term had become fixed in the public mind.
To DG, National Geographic has been a prominent and considered authoritative medium and a voice for evolutionists. When you get hung up on “peer reviewing” and a specific instance is cited, then you merely deny the validity of what is, perhaps the most highly recognized apologist for evolution. So the name of your game is “natural selection”, picking and choosing what supports your views and sweeping the rest under the rug. This is not what I would consider scientific and intellectual integrity!
To Allen, Ken Miller seems to have taken over the role vacated by Stephen Jay Gould as the prominent apologist for evolutionary fairy tales, I understand that his text with co-author, Joseph Levine is used by half the public schools in the country. That is quite an accomplishment and reaches millions of students. In spite of what they include in their texts, you too change meanings, phrases and words to suit the occasion.
Why can’t you, DG and other evos develop scientific and intellectual integrity to allow honest debate instead of the tedious, blind and shopworn tactics that anything that contradicts your hypothesis needs to be denigrated, denied and, as the situation dictates, change the rules. I can’t fathom why it seems impossible to accept scientific evidence that might cause one to reach conclusions that might be counter to preconceived notions. As scientists this is what we are supposed to do, in the name of searching for truth. It is not for the purpose of propagandizing or proselytizing favored concepts. The weight of all the evidence should be the determinant not what is picked, chosen and filtered to press one view.
To take this issue of “peer review” one step further, it is often mentioned that few articles appear in support of creation or any other alternative theories. The simple explanation is that such articles are censored. There certainly is a great deal of scientific evidence to support creation and ID that deserves consideration by any open minded scientist, but unfortunately it will not be found in Natural Geographic, Nature, television or the Biology classroom. The sad part is that it is at the students’ expense!
ba77 wrote:
"Since Patrick already pointed to Dr. Behe’s work,..."
Philip, Behe hasn't done ANY work on malaria. None.
"... in which malaria was subjected to extreme pressure to evolve complexity..."
You have zero evidence to support this.
"... and failed to generate even one novel protein/protein binding site."
Wow! You don't have a clue. Behe was cherry-picking from reviews about chloroquine resistance. The mutations most responsible for resistance are in a transporter, and chloroquine isn't a protein. Where did you get the idea that chloroquine resistance would, even theoretically, involve novel protein/protein binding sites?
Have you considered reading and learning before pontificating?
Ron's initial false claim:
"In all of the literature NS is referred to as “survival of the fittest”."
Both Allen and I pointed out that Ron's claim was false, with Allen pointing out:
"No professional evolutionary biologist refers to natural selection as "survival of the fittest." Indeed, even Darwin didn't..."
Ron, too arrogant to admit his false claim, then modified his claim to:
"I refer you to the textbook “Biology” co-authored by Kenneth Miller and Joseph Levine. In the section titled “Survival of the Fittest", pages 380 and 381 it states” This was a process that Darwin called survival of the fittest. ”"
Ron, can you explain why you didn't admit that your first claim, about ALL the literature, was false?
And why would you try and refute Allen, who explicitly stated that no professional evolutionary biologist would make this mistake, by referring to the mistake in a book written by authors who are not evolutionary biologists?
How does that support your initial claim that natural selection is described as “survival of the fittest” in ALL the literature?
If you're a Christian, why don't you show some humility?
Ron:
Natural Geographic is equivalent to Scientific American, Popular Mechanics, etc. A scientific magazine geared towards publishing work from the world of the natural sciences, anthropology, etc. to a general audience.
In the Archeoraptor case the work was rejected from Nature (and several other journals) because the science wasn't up to snuff. However the "news" article that was supposed to be published in parallel with the scientific publication went ahead even though it shouldn't have. There is no sweeping under the rug, like I said mistakes were clearly made by those involved but Natural Geographic is not an authoritative source. It does serve its uses though in terms of educating the public.
As for the scientific community censoring ID/Creationist work, you do not seem very aware of how often very controversial ideas get published as long as the science can stand on its own. Look at when Endosymbiotic theory was first proposed. It was ridiculed by many leading biologists but it managed to get published in top notch, peer-reviewed journals because there was sound science behind it. As time went on it became more and more validated because the data supported the theory. ID hasn't done this and in interviews Johnson, founder of the modern ID movement has admitted that ID does not have a scientific framework built with enough work to back it in comparison to evolutionary biology.
If ID had work that could stand on its own it would be getting accepted in peer-reviewed journals, no matter how controversial.
Excellent blog. Will come back for more.
Allen,
I believe the suggestion that "RM+NS" is a "strawman" is unnecessarily harsh. You know yourself that people, biologists included, use terms with greater or lesser precision.
Example: Evolutionists will casually refer to "natural selection" doing/creating/making this or that. I know you know this is inaccurate, since NS doesn't create anything -- it preserves (or doesn't preserve). Yet, if we listen to what they mean, they may actually know better and are using NS as a (inaccurate) shorthand for the larger process.
Well then, it seems plain enough that people referring to Random Mutation don't actually mean something as specific as a point mutation. What they intend is clearly something as general as Undirected Heritable Variation (UHV). [Any objections to UHV?]
It is fine to encourage everyone on both sides to be more accurate in what they say and the terms they use.
But it is unnecessarily ungenerous to impute nefarious motives when someone is simply using a term generally and broadly.
Here is an indicator. I submit that if you substitute something like "Undirected Heritable Variation" as a better term, the content of what they are saying would in almost all cases be unaffected. If so, then it is ungenerous to imply the case they are making depends somehow on sneaking in the inaccuracy of "RM".
You've already made important contributions toward better use of Natural Selection. Please continue to encourage better use of terms on both sides, for both heritable variation and for natural selection.
I would suggest you will get better response if you don't imply their inaccuracy is some kind of trick or intentional strawman attack.
Thanks,
ericB
Just a quick late word. Without any truck for creationism or ID, let me disagree with you about at least the source of genetic variation, absent human engineering. It is ALWAYS most elementally random mutation. This is because the gene itself only replicates. Other processes follow (including sexual reproduction) but these use the same raw material and any variation in it is due to "random mutation. If we go back to the granddaddy cell of all life on this planet and ask why we are all not the same cell or an exact replica of that cell right now, the answer is fundamentally random mutation.
Our persisting difficulty in grasping and accepting this fact is not a comfort for creationism or ID. However, when and if we learn to control the chemical processes that biological organisms are made of, we will be forced to also face the fact that we have finally achieved what for millennia was thought of as the key attribute of God, creator of life. With that status will come a whole new and different test of understanding of ourselves and the source of our ethics.
In the meantime, it's difficult enough to remember that that slimmy green thing slithering in the mud is my very distant cousin.
"It is ALWAYS most elementally random mutation."
This is not true. You should check out Caporale's work. There's an entire volume that she edited titled "Molecular Strategies of Biological Evolution" - the point being that the evidence is pointing to genetic change as something _managed by the cell_, not something haphazard.
Take the immune response, for instance. The mutations that occur during an immune response, while they are not entirely deterministic, they do in fact limit themselves not only to the right gene, but the right SECTION of the right gene. The part of the gene that is responsible for attaching to the cell (for which variation wouldn't help in any circumstance) are in fact not touched during mutation. That's a heavily directed mutation.
There are many other examples. As a quick one, Barry Hall showed that E. Coli's genes for digesting beta-glucoside sugars were normally inactive. However, in starvation conditions that occur in the presence of beta-glucoside, the cell actually modifies its genome with an insertion sequence to activate this gene. That's right - a direct response to a stimulus causes the cell to modify its own genes in a regulated way.
Caporale did a review article of many of the general mechanisms that have been found in the genome, which I have summarized here:
http://uncommondescent.com/intelligent-design/tuning-knobs-and-other-features-of-the-genome
And I think she (or maybe it was just my summary) even left out phase-variable genes.
I think that the worst straw men are the "I've never seen no cat-banana hybrids." No, it's "If we developed from rocks, why don't you put your children out in the garden to photosynthesize?" Something like that.
I wrote:
"It is ALWAYS most elementally random mutation."
crevo said...
This is not true. You should check out Caporale's work. There's an entire volume that she edited titled "Molecular Strategies of Biological Evolution" - the point being that the evidence is pointing to genetic change as something _managed by the cell_, not something haphazard.
Take the immune response, for instance... That's a heavily directed mutation.
There are many other examples. As a quick one, Barry Hall showed that E. Coli's genes for digesting beta-glucoside sugars were normally inactive. However, in starvation conditions that occur in the presence of beta-glucoside, the cell actually modifies its genome with an insertion sequence to activate this gene.>>
This is the problem with path that a lot thinking in this discipline has taken -- reflected in what Allen MacNeill tried to say in "RM & NS: The Creationist and ID Strawman."
When MacNeill lists other sources of "evolutionary variation" besides random mutation, he's just opening up the door he thinks he's closing.
Any mechanism that causes variation in organisms ultimately must come from random mutation or intentional variation. There's no in-between. The mechanisms MacNeill mentions were all ultimately produced by random mutation. Some organisms that may "evolve to evolve" must still follow a path of random mutation to reach the point where increased variation becomes a survival strategy.
The E. Coli example given above is of course in the same category as any variation that departs from an earlier biological form -- the change or the ability to change as seen by a consistent theory of evolution is always ultimately generated by random mutation.
The lateral exchange of genes as a source of variation for example either came out of random mutation or was the result of intentionality of some kind.
Naturalistically, there is no evidence of intention. Yet, we see evolutionists mentioning other "sources of variation." And thus we get the silly notion of the "selfish gene" -- which incredibly ascribes intentionality to the gene itself or organisms as agents of the gene. TV science programs speak about evolution "designing" organisms to fit their environment.
And now teachers who should know better are numbering sources of evolutionary variation as if they were somehow outside random mutation.
Yes, there are other selective mechanisms besides Natural Selection, in the natural adaptive sense. Domesticated plants and animals are often the product of intentionality -- when we breed hogs to yield lower fat pork, there is an objective in the minds of those doing the breeding that is "realized" in subsequent hog populations.
But, as naturalists, either evolutionary scientists are going to have to learn to live with random mutation as the ultimate source of biological variation -- or they had better start figuring out where exactly the non-accidential element in evolution is coming from.
Steve Long
My take on the whole post was that the strawman being erected was random point mutation.Allen then went on to list all of the other sorts of other non point mutations.
Of course they are all random in that they are stochastic processes but I prefer to use that word, stochastic, over random. To the layman random tends to mean a situation where all events are equally probable, which would be some stochastic processes drawing from the uniform distribution. Not terribly exciting. Mutations don't draw from that distribution, and while there is this random element to it the nature of that distribution certainly introduces boundaries and makes some events more probable then others.
It may be a fine point, and one that scientists and especially biologists intuitively understand but layman don't necessarily know that and creationist exploit that lack of knowledge ruthlessly.
"Of course they are all random in that they are stochastic processes but I prefer to use that word, stochastic, over random. To the layman random tends to mean a situation where all events are equally probable"
That may be true, but I think the true import that those (like myself) criticize random mutations on is the claim that a mutation is indifferent to the survival benefit of its host. Uniform probability is the appropriate baseline to test this against. If mutations that exist in nature are much more likely to be beneficial than a mutation decided at random with uniform probability, then the idea that mutation is indifferent to the survival benefit of its host is lost. Uniform probability is not what ID'ers propose is the alternative explanation to ID, but rather that it is the baseline against which to test whether or not given mutations are random.
Crevo,
Your comments are completely tangential to mine and you seem to be lumping together the ideas of a mutation occurring, with the idea of that mutation spreading so some percentage of the population as an allelic variant, and its fitness effects.
Even when combining everything in to a model, after all our models of amino acid substitution are typically modeled as Markov processes, we are then looking at the probability of a substitution occurring. These models are definitely not drawing from a uniform distribution there is no good reason to believe that a uniform distribution should be a base line at all except for possibly the stationary distribution after infinite time.
Over snapshots of evolutionary time, that is the timescale that evolution is actually occurring on, the substitution process is going to be anything but uniform. Anyone who thinks that the baseline for the substitution (via mutation) of (for instance) an isoleucine in the hydrophobic core of a protein for Leucine versus Aspartate or Tyrosine will all have equal probabilities of being an accepted substitution clearly doesn't understand biology.
For mutation alone (forgetting for the moment whether that mutation will be an accepted substitution at all) anyone who thinks that a mutation from Methionine to Isoleucine is as probable as the mutation from Methionine to Arginine again, needs to brush up on their basic biology.
These are both relatively simple examples of why the probability distribution for mutation alone will be decidedly non-uniform as will the probability distribution of a substitution (which in terms of fitness effects just has to mean that the mutation isn't non-viable/fatal it doesn't need to be positive or even neutral, just not fatal).
Once we start talking about whether something is beneficial or not we are getting in to fitness effects and using a uniform distribution as a baseline is going to be even more invalid. Uniform distributions are rarely very interesting in biology, except as a null hypothesis and if that is what you were trying to suggest in your post I don't think you really set up a proper null, nor a competing hypothesis to test against.
DG -
If one group is to say, "beneficial mutations are primarily directed by information within the cell, not haphazard events" and another group is to say "beneficial mutations are just the results of haphazard mutations that are in the right place at the right time" how do you tell these two hypotheses apart? The way you do that is by establishing a baseline which would be considered "no information". In information theory, a uniform distribution is in fact the "no information" distribution - it is the search that performs best when there is no information contributing to the search. So, the question is, is the search techniques employed by the cell to cause mutations (a) better than "no information", (b) worse than "no information" [i.e. the search is directed at the _wrong_ points, and skips the beneficial ones], or (c) somewhat equivalent to "no information".
The problem with your critique is that you are using the physical processes that exist in the cell (which is why you are choosing Markov modeling) as the comparison. However, the question is not "what is the physical process by which the cell works," but rather, "is the way that the cell works one in which it is heavily biased towards beneficial mutations or not". The way to measure that is by comparison with a uniform distribution.
Crevo,
I've personally yet to see the ID folks actually use information theory properly. Usually they pull out a mismatch of Shannon Information Theory, Kolmorgorov Complexity Theory, and Colloquial usages of the word information and mash them altogether in to a soup that makes no sense scientifically.
For instance what do you mean by beneficial mutations being primarily directed by information within the cell? Even if that is true, and of course one could argue that the physical constraints of biology and of the processes going on in the cell certainly do that, it has no bearing whatsoever on whether an intelligent agent was behind that. Which is what ID argues.
And again you come back to erecting a strawman of reducing evolutionary biology to "beneficial mutations are the result of haphazard events in the right place at the right time" it both oversimplifies to the point of absurdity as well as ignores most of evolutionary biology post-synthesis. Namely neutral theory. There are, in simplest terms, two processes at play, one is mutation and the other is selection. Mutations happen, it is their effect on fitness that determines whether they are beneficial, neutral, nearly neutral, or deleterious.
crevo wrote:
"If one group is to say, "beneficial mutations are primarily directed by information within the cell, not haphazard events" and another group is to say "beneficial mutations are just the results of haphazard mutations that are in the right place at the right time" how do you tell these two hypotheses apart?"
crevo,
This is just ludicrous. When real scientists do science, it's not "one group says..." and "another group says...," it's about "one hypothesis predicts..." and "the other hypothesis predicts..."
Why are you conflating science with high-school debate?
Why can't any ID proponent be bothered to test an ID hypothesis? I hypothesize that they know that ID is BS, so they misrepresent science as high-school debate.
What does my hypothesis predict your response to this charge will be?
-DG said...
--Of course they are all random in that they are stochastic processes but I prefer to use that word, stochastic, over random. To the layman random tends to mean a situation where all events are equally probable, which would be some stochastic processes drawing from the uniform distribution.--
But statistical randomness is NOT a uniform distribution. It's the bell-shaped curve. The degree of variation varies, and less variation is more probable than relatively more variation. But survival may favor the improbable variation, not the the more likely one. That's why in evolution that's not directed by (human) intentionality, the general rule is, the more mutation the better. It widens the statistical range against an unknown variable.
--For mutation alone (forgetting for the moment whether that mutation will be an accepted substitution at all) anyone who thinks that a mutation from Methionine to Isoleucine is as probable as the mutation from Methionine to Arginine again, needs to brush up on their basic biology.--
But you've loaded the dice with that example. If there is going to be a mutation in the chemical process of synthesizing Methionine, neither of the above is likely. You are already looking ahead to substitution in making this evaluation -- the choices you give are purposely narrow. There are many, many mutations that evywould not be viable -- but evolution does not know that until after the mutation occurs and not before.
When there is a probability that one mutation is more likely than another, that has nothing to do with viability. The most likely mutations may be completely disasterous to the organism. The unlikely -- or even even highly unlikely -- mutation may in fact be the one that lives on.
The second that we stop thinking in terms of what survives and start thinking about the non-intentional process that must have driven evolution, there is no choice but to understand that random mutation only can have driven that evolution.
Any other point of view is giving ID room to ask where the absurd "luckiness" of evolution came from. There is no luck in evolution, just many, many blind alleys and dead ends. And a very occasional "mistake" that happens to work.
-Anonymous said:
--But statistical randomness is NOT a uniform distribution. It's the bell-shaped curve. The degree of variation varies, and less variation is more probable than relatively more variation. But survival may favor the improbable variation, not the the more likely one. That's why in evolution that's not directed by (human) intentionality, the general rule is, the more mutation the better. It widens the statistical range against an unknown variable.--
Check the context that I was writing in. Of course statistical randomness isn't uniform (although it can be) statistical randomness just means drawing from some sort of probability distribution which was my point. I was arguing that to the average person random means all events being equi-probable which is not the case in evolution. I was arguing against crevo who was insisting that the uniform distribution should be the baselines which is absurd.
-- But you've loaded the dice with that example. If there is going to be a mutation in the chemical process of synthesizing Methionine, neither of the above is likely. You are already looking ahead to substitution in making this evaluation -- the choices you give are purposely narrow. There are many, many mutations that evywould not be viable -- but evolution does not know that until after the mutation occurs and not before. --
Of course I did. In that case I was merely talking about substitutions and how the effect alters the distribution of the process at the substitution level not the mutation level. I went on later to talk about how the distribution for mutations is shaped by things like how many mutations need to occur at the codon level for a given substitution.
My comments really need to be read in the context of how I was replying to crevo nad his absurd proposition about what distributuions are appropriate as the baselines models.
nice post
Post a Comment
Links to this post:
Create a Link
<< Home